Can you provide the document about the identifier of reads?

Can you provide the document about the identifier of reads?

Michael (guest) 18 May 2010 17:03

I generated a fastq file with Flux Simulator, but I cannot understand what the identifier of the read includes.
For example, in the identifier "chr1:3361086-3361517W:U319578-1:4:432:-9:211:1:40", the first is chromosome name, and then is range of the fragment or cDNA, transcript ID. But I cannot figure out what the rest of identifier are.

chr1:3361086-3361517W:U319578-1:4:432:-9:211:1:40 0 chr1 3361076 255 50M * 0 0 CCTAGCTCTTCTGCAACTTTTCTCAGACATTTTCCTAGACTGCATCTATT a]Ya_bbaW\bba^^aUb_X`b_bbab```_^\^XBbbaTab`baH`ba] NM:i:0

Anybody can provide the document for me?
Thanks

Re: Can you provide the document about the identifier of reads?

gmicha 26 May 2010 15:08

Hi Michael,

tokenizing the read name at ":", the fields are

chromosome	name of the chromosomal sequence
locus	start-end, W=Watson strand, C=Crick strand
transcript_id	ID for the transcript in the reference transcriptome
transcript molecule number	consecutive number of originally expressed RNA molecules
transcript spliced length	length of the processed transcript (in nt)
fragment start	start of the cDNA fragment in transcription coordinates; values <0 are before the annotated transcription start, values > (transcript spliced length) are after the annotated transcript end (polyA)
fragment end	same as (fragment start), however, describing the further downstream end of the cDNA fragment—referring to the transcription direction
read start	start of the read relative to transcript
read end	read end position in transcript coordinates

Following optionally after a "/" are attributes of the read, identifying e.g. mates of paired-end reads, or the strandedness. See also the BARNA descriptor.

Best wishes,

micha